EST 1075138 is a singleton


Sequence

>1075138 (1 EST) Length=384 GTCGTTTCATCGGACTGGTCACTGAATAATGCTAATGAAGGATGTTGGGTTGGAATCTTGCTATTCGCACTTGTCTTAGA CCTATCAATCAGTTTACTTTGCTCCATGTTTCTCACTCAAATCCAGAACAGTAAACTGAATTCGGTTGTTCCGTGACAAG TTTTGAACATTGGTTTTGTATGAAATGCCTATTGTTGGTGAACGCTCGAAGTTCTCATGCTTGAAAATTTACGACGATAC GAGTTCGTCAAGTGATGGTGATAATGGCACGAAATTGATGAGTAAAGTGACACCTAGCCAGAATAAAAAACATGAGAATC AGAAAAAATCAGCTACATGCAAGAATAGTAGCGGTTTCATTGTGCATTCCATACCACAAAAGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1075138: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751382113615AA430819RRAMCA1545SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:3:55 on Sun 19 Nov 117.