EST 1075145 is a singleton


Sequence

>1075145 (1 EST) Length=167 GAAAATTATAATGAAATGTTTCTGTTGTTTCACATTACACGTGCGCTGGTTTCTCTCTCGTTTATCTGTGATGTGTGTTG TCGGTTCTTTGGTCATAGCTGGTCATTTTGCTGGTCATTTGATGTATTCTGTACTGATTCTTTCTAAATGATAAAGATCA TCTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1075145: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751452113622AA430826RRAMCA1554SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 22:11:14 on Fri 17 Nov 117.