EST 1075162 is a singleton


Sequence

>1075162 (1 EST) Length=378 ACGTTTCACTGTTTATTTGGCTGATTTCACTAGACTCATTTGTTCAAAAAATTCTATTCCCTGTATTGTGATCTGCTGAA AGAAATTATTTTTTGTTTAGCACATTTTTTTTACGTAATTTTCACAGCATAACTAATCAGCGGTATTTCTCAAGGACACA AGCGTTTGAGTTTTGTCAGTGTATTTGATTATAAATTCATTCATCTTTATTTTTTTCATTTCACATTGTTATATTCGGTG TATGTGTTTACGATTATAATTTCTGCATATATTTTTATTGCACGACTGTCCACGAACATAATCTCAGTTTTCTACTCTNT GTTTTCTACCTNCTATGATATTCATATTTAATTTTAAGTAAAATCTACACAATTTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1075162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751622113639AA430843RRAMCA1573SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 7:16:41 on Mon 20 Nov 117.