EST 1075180 is a singleton


Sequence

>1075180 (1 EST) Length=308 GGAAATAATTAACTTAAAGGTTAATTGGAAACTTGAATAACTATTAACAACTGATGAACCACCGGGACAGCACCGCATAT TCGGCCTTCCGGTCATCGATCATGTTTCAATGATGCGATTTCATGTCGTTTAATGAAACAGTCAGACGAATGTTTGAAAA CCTGTTTCATGGCTTGAGCAACATTACCGCCAATTTGGAATAGGCTGGGACGGTTCAACGACAAACGCGCATCTATCAAT GCAATTTTGGCGGTTTACTTAGACAGGTTGCAAACGATGCGGAAAATTATGTATTGAAATGGATGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1075180: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751802113657AA430861RRAMCA356SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 7:10:24 on Mon 20 Nov 117.