EST 1075194 is a singleton


Sequence

>1075194 (1 EST) Length=174 ATTAGAAACATTTTTAAGCAGTTTACAAGAAGCTTACAAGCAGGCTTATAATCAACCAATTACAGTCAAATGGATTGATA AAGAAGGTNATCCATGTACGATATCATCTGCAACGTGAATTAGACGAAGCGATACGTTTGTTACATCAAATGGTAAGCAG AACTTAACGTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1075194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10751942113671AA430875RRAMCA482SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 6:39:50 on Sat 25 Nov 117.