EST 1077445 is a singleton


Sequence

>1077445 (1 EST) Length=580 TAGTGGAACAGTCGTTGGTTGGTGTTCAATTCGAAATTTTCAACAAACAACAATTGCAATCATTCCATATCTTTTACTAA CATTATTATTTTCAATTATTTCAGTAACAGTATGCGGAAATAGATCACGGTAGTGAGGTTTTATTTATTATTAACATATC ATAATATTTATTATGAAGTTTTGAAATGGAATTAATTATGTGATAATATTTGAGCAAAAGATTATATACATGATTTGAAT AAGCTTTATAATTATAATTAGACCTAAAGATTAAAACATTTCAATGAATGAATATTACAGCGATGAATATCCAGAAAGTG AAGAATATTCATACATATCGAAATCAGAGGAAAATTATCAAAAGAATAAAGATATGCAGAAGATATGGTTAGAGTTAGCA GTTGACATGTGTCAACAATTGTCATCATTTCTGGTTATTTATTTGTNAAATCAAATTACAGCACCGATATNATTGACATT TAAAAATCGGATCCCGTCAGAATATGCTATCACCACTATGACTGATAATCGATAACTGAAAAATACTCCTCCACTTTATC GGACTTTAAAGTGAATTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077445: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10774452125749AA433151RRAMCA1590SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 0:56:40 on Wed 22 Nov 117.