EST 1077458 is a singleton


Sequence

>1077458 (1 EST) Length=440 TTACAAGAAGGTATTTAATAAATAGAGCAAGTCTTCTTCTCTTGACCTGAAACTAACATTTCGAGTGAAAAAGTCACATT GAAAAAAACAAACATTTAACATTTAACATGGGTGCAGCTGTGATTCTATTTCTACTCATTTTAATTGGCCTCGGTGTTGC CTATCACATGGGAATTCTGGAACCTTATATTAAGGAAGCTCAGGCACGAATGAAACAGGGTGGTGGTGGTGGACCTCAAT AAAGGTTTAATCGATTTACTCTTCGTTTTCGAATAAATTCATCTTTCTTGGTGGAAAAAAAATTCAACCGCTTTGAAGGC TCAAAATACATAAATCCGAATCGAAGAACAGGAACCGATCAACTTATCTTACTACAAGGAATATACGTACATATAATATA TACTGACTGATGTGATACATTCATTACTTAATTCGCTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1077458: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10774582125762AA433164RRAMCA1606SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 2:30:15 on Mon 20 Nov 117.