EST 1077459 is a singleton


Sequence

>1077459 (1 EST) Length=378 TTATTTCAATACTGATAAAATATGGCAGGGTACAGGGGGGGGGGGGTGAACTTGGAGAGAACGTAGAAAATATCTGCGGT GTTATTGATTATGATAAGCATGCATTCTTTATCACATGCACAGAAGGTGACCCAATAGATCGAGAATACACACACACATC AAGTTTATGATGATANAGCGCCTGATACTGTNATGCATATGTTACTTGCAAGACATGATAAAACANGTGATCGGAAGAAT ACAGCCATNCATCGNACTGTGAAANTTTCAGAATTGGTCAAAGGTCGCTCTGTGCATTTTCCAAANATTAATTTGCTATG GTCGTCTCAGAAAGATGATATTTGGTGACAGNGGAGATCAGGATGCTGAACGGGATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077459: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10774592125763AA433165RRAMCA1607SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:14:23 on Mon 20 Nov 117.