EST 1077587 is a singleton


Sequence

>1077587 (1 EST) Length=415 AGTTTCTGTACTATATTGAAATCTCGTAGGGATAGCTAAAAACCAAACGAAAAAAAAAAAAAAAAAAAAGTAATAATAAT AATAACGCAAAAAAGGAAAGCTTGAAATTTGGGCGCAATGTCGGTTGACTGGACTGCAGTGAGCCAAACCATCTCTGCGG AATGGGACGAAACGGTGTTGCCAGCTCTCTCCGCATACATTGAAGTTCCCAACCAAAGCCCTCACTTTGATGCGGAGTGG GCCACCAACGGCCTCATGGGCAAGGCCATGGACGTCATTNTGGAATGGGTGAAGAACCAACCCATCAAGGGCTTAAAATA TGAGGTCCTGGGAAGAGAAGGGTCGNACGNCTTTCCTTATTTGTGGAAGTTGACGGGGCCAGGAACCCACAGCCCAATTA CGGTGTTTGCTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077587: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775872130770AA433293TEUF0108T.cruzi epimastigote non-normalized cDNA Library


Date: 5:9:22 on Sat 18 Nov 117.