EST 1077589 is a singleton


Sequence

>1077589 (1 EST) Length=226 GTTATTTTGTTTATACGCAAACAGTTAGGAGGAAAAGACTGTCGCAATGGCGCAGAAGAGGTTGAAGGGAAAGTCCCACG AAAAGAGCGGCGGTGCCCTGCGCAAGTCCGTTGGGGATTCGAAGAAGAAGACCGTCTACGGGAAACGGCGGAAGACAATT GAGGCGAAGCCGCGGGCAAATTATGCTTCCGCCGTCGAGTCGCGTATGGCTTCTCGCGTGCCGTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077589: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775892130772AA433295TEUF0111T.cruzi epimastigote non-normalized cDNA Library


Date: 7:35:53 on Sat 18 Nov 117.