EST 1077594 is a singleton


Sequence

>1077594 (1 EST) Length=220 CTTTTCTACGCGTTTAGGGCTGGGTGGACGGGGTAGCAACGCCACCGGAGTGAAACCATACATATTGTCTCCTTTCATTA ATGCTCAAAGAGGCCTCTGAGTACATTTGTTCCAGCGGTGGGGCTGATGGGTGTGCTTAGGATTGACAATTCGAAGACTC TGTGAAGCGAAAAATCTCTTTTTGTTTTGTTTTTCCTTTTTACCTATGTTGCTTGATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077594: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775942130777AA433300TEUF0119T.cruzi epimastigote non-normalized cDNA Library


Date: 21:10:38 on Fri 24 Nov 117.