EST 1077598 is a singleton


Sequence

>1077598 (1 EST) Length=186 CATGCATGCATACATATATGTTCCCACACTGTCCCTTTTTTTTTTTTTTCTTATTGTTGTTGTTGTTGGATTTTTTGTAT TCTTCTGCCTCCCTGCGTGGGGTGCTTGCTTCGTTTTGATGCACCACAATGATGCCATCATGAAGGCAGTTTGATTGAAG CCTATAAGNCCAAAATCATTATTTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077598: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10775982130781AA433304TEUF0127T.cruzi epimastigote non-normalized cDNA Library


Date: 16:16:58 on Sun 19 Nov 117.