EST 1077601 is a singleton


Sequence

>1077601 (1 EST) Length=167 CATTTTGTTGATTCATTAACATAAGTGGTTTTTTTTTTCATTTTTAGTTTTGGTTACTTTTTCTACCACCCTTTCACATC GGTCAAATGCCTTCAAGAGGAAGGCCGGAGGAGAGTGGTTACGAATGTCACTGCACCGATACCTTCATTTCAAGATGAAA AATTTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077601: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776012130784AA433307TEUF0130T.cruzi epimastigote non-normalized cDNA Library


Date: 9:34:55 on Thu 23 Nov 117.