EST 1077604 is a singleton


Sequence

>1077604 (1 EST) Length=213 GACGCGGCAAAAAGATGTCCGCGAGCGGTAGACCAGCAAAGACGCAAGCCCTTATGTTTGCCTCTCGGCCCATTGTGATT TGCTGCATTTCATCGGCCCGGTGCCTCACCCTTACGGCGGGCCAAACCCGCAGACAATTGCACAACGTGCCTCGCAATAC GTGCGTTTTTCGTGCGAATACCTGGTGAGAAGGCACCGGACCGTGAACAGTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776042130787AA433310TEUF0137T.cruzi epimastigote non-normalized cDNA Library


Date: 9:4:58 on Sat 18 Nov 117.