EST 1077606 is a singleton


Sequence

>1077606 (1 EST) Length=168 GGACAAGAAGAAGAGGAAGAAAAACAAAAAAAAAAAAAAAGGAAGAAGAAGATGTAAGAATAAAAAGAACATACAAGATT TTATCAGGCGGTCAGATTGAATAAGGGGGAGATGAAAAGGGGAGCCGAAAAGGAGGAAAACACCAGGGTTTTTGATGCAT GTGGGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077606: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776062130789AA433312TEUF0143T.cruzi epimastigote non-normalized cDNA Library


Date: 1:13:35 on Tue 21 Nov 117.