EST 1077610 is a singleton


Sequence

>1077610 (1 EST) Length=318 CTATATTGTTCGCTGAAGATACAAGGATATTAAGAATTAAGCAGGGAGATAATGGCCACGGCAGCAGTTGAGCGGCCAAC TACGGCAGAGGAGCGCGTTCTCGCCTTGAACAACCCGCCACCGCGGCCACAGAAAGCCCCGGATATTTCTCATCGCCAAA GGGCCGCTATCAACCCCGAGGTGCAGGCGTTGCAAGATCGTTAATGAATGGACCAGTTGCCGCTGACATTCCGGACTCTC CGCCACCGGTTGCTGCCCCTCAAAAAAAATTGTCCATGGGGTTTCCCTCTGAATTTTTTGCCGGCCCAAAGGACCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077610: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776102130793AA433316TEUF0015T.cruzi epimastigote non-normalized cDNA Library


Date: 7:12:47 on Mon 20 Nov 117.