EST 1077613 is a singleton


Sequence

>1077613 (1 EST) Length=267 GTACTATATTGGAATATTAAAAATTATTCAGGTATTCACTAGACATGTTGCGCAGGTCCACAGTTTTTCTTTTGGGTGCG TCCCGCATGCTCTTTTCGGGGGGAGGCTCGGGCCTACACCGTATCAAGACAAGGCGTACCCCGTACAGCCTCACAGCCTG AATGAGCTTCACAGCCACCAGATACATGGCGGTAAAAGTCCATTTTTTGGGCAAGTTGATGGATCAATCTCTTCCAGTCT ACGAACGATGTTGTCACCGGGTTCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077613: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776132130796AA433319TEUF0153T.cruzi epimastigote non-normalized cDNA Library


Date: 17:10:43 on Wed 22 Nov 117.