EST 1077614 is a singleton


Sequence

>1077614 (1 EST) Length=311 AGTTTCTGTACTATATTGCATGAAATAGTAACGACTGACAGCAACAGCCCAGAAAACAATAACAAATTTATTTGAGCTTT TTTTTTTTTTTTTTGTGTGTGTGTGTGTGTGTTTGTGTGGTTTTAGCTTTGCGTAGCACGTCCCGATACATTTTCCCGCC AAGCAGCCGGGAGACATCGCCTGACGGGACTTACATCGTAGCAACACGCCGAAGGAAATTTCGGCTGTTTCTGTTTCGGN CTCCTCGCCCATTCGCAGGCGTCAGTGCCGGGTTTAACAGGGCAACCGCAAACGTGGGGGGGAGTTTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077614: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776142130797AA433320TEUF0159T.cruzi epimastigote non-normalized cDNA Library


Date: 12:0:12 on Fri 24 Nov 117.