EST 1077615 is a singleton


Sequence

>1077615 (1 EST) Length=301 GAAGTGATGAGCGAAACGACCATCGAAACACACCATGCATTAACGTCGGGTTTACATGAACGTGCACGGGGAATTATTGC GCGGTGGAATCGCTACGTTGCGCGGGCCCAGGTGTTGTCAAAAGGATTTATTTCAATAAAGGGATACTACTTTGAAGCCA TTGTGCGTGGGGAACGGGTGCGCTGGTTGTGTCCCCACGAGTACGCGCACCAAGTTTCCGCCCGGTATTCAGCAGTATAT TACTCTCAGTTTCTTGGAGNTTTACGTTGAGCTTATGCAATTTGTTTTTGGACAACCTTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077615: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776152130798AA433321TEUF0161T.cruzi epimastigote non-normalized cDNA Library


Date: 4:25:10 on Wed 22 Nov 117.