EST 1077618 is a singleton


Sequence

>1077618 (1 EST) Length=305 CGATGTAGAGAGCGCTGAGATGGTGAACCCGCGTGTTCTTCGGAAAGCGGTTATATGTCTTTTAATTCCATTTGTTATCC TTATTTTTATCAATGGCTCCTTTTTTGCACTACAATTTATCACGGTGACTTTGACTTTTTATTTTGTGAGTCTTGGCTAC TTTGTGTCGGAGATTGCCATTCGCCCGCCGTGGTATCACCATCATCCAAAATCCAACGAAGCTAACGATGCATAATTTGT CCCGGATTATTGGAACCGGATACTGGCCATGATCCAAAGGAGGAGATTTTTGGGGCCTTGAGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776182130801AA433324TEUF0168T.cruzi epimastigote non-normalized cDNA Library


Date: 4:25:3 on Fri 24 Nov 117.