EST 1077619 is a singleton


Sequence

>1077619 (1 EST) Length=263 GAACTGGGAGATGCCAACAAGGCGGTGGATGTCATGACCTCTTTGTGGCAGATGCACCACGAAGTGGAGACGGATCCGCG CGTGGATCAACTGGCGAATTGGATTGTTGAGCAATCGGAGGAACTCACTGAAGACGCCATTGGGAAGCTCTGCGCTATCC TCAATGATAGGAACTGGCGACATGTTCCGCTTGTAAAGGCCATGGCGGACAATCCGTTCGATTGCAGCTTCAGCAAAGTG TTTCAAGCCGAGTGCTTGCCGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077619: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776192130802AA433325TEUF0169T.cruzi epimastigote non-normalized cDNA Library


Date: 2:51:41 on Mon 20 Nov 117.