EST 1077620 is a singleton


Sequence

>1077620 (1 EST) Length=274 AGCTTGCCTACGCGGGGGCTTCTGTGCCTCCAGCAGGTGTGGAGTTGACAATTCCTCCTTATTCTAACCCTTTTGCCGCA AATAATGCGCCCCCCTTTAATGACAGGCTGCGTGTGCCACTGCTGCCGCAGCAGCAACCACAACAACCGCAACAACCATT CCAGCAGCCACCAGCACTCTGTGCACCGTGGGGAATCCAGCTGCCGTCGCAGCCTCCATTTATGGGGCTTCCCCCGCCAT GGGCCGGCCCTGGTATATTTGACCCCGGCGGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776202130803AA433326TEUF0171T.cruzi epimastigote non-normalized cDNA Library


Date: 19:18:53 on Sun 19 Nov 117.