EST 1077623 is a singleton


Sequence

>1077623 (1 EST) Length=263 TGACTACGTTCAACGGATTGAATTTTGTAAATCTCGGGTATCAGCCCTGCCCGATGTCGTTGGAACCTGCAGGAGATAGG GTGGAGATTCTCATTAAAATCGTCAACTACATGTCCGGCACACTGGAGTATCGAGATGGCCAGCTTATTGGACCTCTCAT GTCAACAATGATTGCGGGAGAAGGCCTTTTTGAAGAGATTGAGGAAGCATTTGGTGAGGGAATTGAATTTGGGAATTGGA CGTCCTTTTTGAAGAAGCTACGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1077623: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776232130806AA433329TEUF0175T.cruzi epimastigote non-normalized cDNA Library


Date: 4:30:2 on Fri 24 Nov 117.