EST 1077624 is a singleton


Sequence

>1077624 (1 EST) Length=159 ACAGTTTCTGTACTATATTGCTGACGTTTTGTGCGGAGTGCACCGATGGAACCGGATGACGTTGCGGAGTACAGCCTTCA AAGCTACTGGGAGAAGCGCTACAGTAAGGAGGACAGTACAACTGGTTTCCGTCCATCACCAGAGTCTGTGCTGGCGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077624: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776242130807AA433330TEUF0179T.cruzi epimastigote non-normalized cDNA Library


Date: 16:4:48 on Tue 21 Nov 117.