EST 1077625 is a singleton


Sequence

>1077625 (1 EST) Length=317 GATGTCCGAGCGTTGGATGCATCCANTCTGAGCCGTGGTGTGTGTGTGTGTGTTGGGTGCATGGAGCCAGAGTGTGATTG CCCGTTTGGCTGTGTCCTCCCCCGCCTTGTGGGAATGGAGGAGAAAAGGGTCCTCCGCCAGGCGCCCATTTCACATTAAG TTCTCCGTTGTTTTCTCTCATCATTTCGGTAGGGAGGGAAGAGCAGGCAAGCAGAGAAGAGGGGAGGTGAAAAAAAAAAA AAGAGAAGTTCGGGACGAAGTTTAGCCCCGTCGGGAAGGGAAGTGAGGCGTCGTTGGAGTTTGTGTGGTGGACCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077625: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776252130808AA433331TEUF0018T.cruzi epimastigote non-normalized cDNA Library


Date: 16:15:45 on Tue 21 Nov 117.