EST 1077626 is a singleton


Sequence

>1077626 (1 EST) Length=157 CGAAGGAATATCTGGACGAGAACATGGTGAAGGAGTTTAACGCACGGGAGGATGTCGCGGAGGCTCGAAGGAATCTGCAG GATCGCATTGCGACGTGGATGAAGGCGGCGAAGGAGAAACGCTAGGATGGAATGTTTTTTGTCTGCGGTTTCTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776262130809AA433332TEUF0183T.cruzi epimastigote non-normalized cDNA Library


Date: 7:2:14 on Mon 20 Nov 117.