EST 1077627 is a singleton


Sequence

>1077627 (1 EST) Length=155 CGCAGGGGTGTGGAGGGGCACACAAATAGTGAGCATAGGTACTGTGCAGCGCACGCACGCACGGAGTTTTACAAAAATTT CACTCTTCTCCAATCAAGCACTTGTCGCCGCGCGAATGGCGTCGCAGAGACCAACCGTGTGGGGTGGCAATGGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776272130810AA433333TEUF0184T.cruzi epimastigote non-normalized cDNA Library


Date: 22:10:13 on Fri 17 Nov 117.