EST 1077628 is a singleton


Sequence

>1077628 (1 EST) Length=195 CTGTACTATATTGTTTGCCCCACCACTACTTATTATTATTGTTGTTAATTTTAGTTTAAACCAGTTGTTGCGAATCTGCA GGGGAATTGAAGGGAATACAGCTCCTTGTACACATAATTACAACGCTGATATTTATTGAAAGAACGGGGAAAGATGATGC GACGCCTCGCTCTTCAGCCCGTCGCACGTCGTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077628: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776282130811AA433334TEUF0186T.cruzi epimastigote non-normalized cDNA Library


Date: 22:15:40 on Sat 18 Nov 117.