EST 1077630 is a singleton


Sequence

>1077630 (1 EST) Length=225 GGTCCGTTGCACAAACGTCACATGATTAACTCCTCTCCATGAAGCGAAAGGCGCCGCGTTACGCGNTGGTATTGGCTTCG ATGTACAGGTTTCGAAGATGCACGCGACATTGCAAAGAAAACGACATTGATATCTTTGAGGCTAAATTATTTACCACTTT TTGACATGTTACCGGACGTTGCTGATACGAAACGCGAGAGGAGGCACGCGCATTGCGGTTCCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077630: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776302130813AA433336TEUF0188T.cruzi epimastigote non-normalized cDNA Library


Date: 7:3:19 on Tue 21 Nov 117.