EST 1077631 is a singleton


Sequence

>1077631 (1 EST) Length=259 GGCGATGTGTGCGTGGATGAAGCGAGGTCTGGATAAAGATAAGCAAGCGGAATACTGGAGGATGGTCAAAGAACTCATGG AAAAAGTGGGGCCGATTCCACGTCACATCTTTGATGAGGAAAGTTATATTGATCGCTTGGGCGCCGTTGATGATGCCTTG TTAGCGATGANACCTACTGATGTTGAAAAGTAATTTTCCCTGGGAAGGAAGTAATCCCCCGGCAATTTCGAGGATCCGTG TCACAAACTTGTGAAGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077631: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776312130814AA433337TEUF0189T.cruzi epimastigote non-normalized cDNA Library


Date: 6:16:40 on Wed 22 Nov 117.