EST 1077632 is a singleton


Sequence

>1077632 (1 EST) Length=230 GTACTATATTGATGGAAAAGCNAGTCCAGAGGAGGCGAGCCAGCAAGAAATACACATTATTTAGTAAATTCTNTTTTACC TGAGGGGGAACGAAGGATTAATATTAGTGGTGGAAGTACTAGTAAAAAAAAAAAGATGGCTGCCCTTCCCGGCGTGTGCA GCAGGCAGCGGATTTATTTTATCCGTGCACGTCAAGAGGAGACGACGGACGGCAATCCTTTCGTGGCTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077632: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776322130815AA433338TEUF0019T.cruzi epimastigote non-normalized cDNA Library


Date: 21:12:1 on Fri 24 Nov 117.