EST 1077633 is a singleton


Sequence

>1077633 (1 EST) Length=185 TGTATTTTGGGATTTGATAGGGGAAAGGGGAATTTGTGAAGGAGAAGCAGCCGCAGGTTTGGAGACTAGAGAAGAGAGCC TTTCGAAAGCATCAGAGTTTTTACGTTTGTTTTGGGGGTNAATTGCAGGAAAGTCGCGTTGTTTTTTTGGGGGTAGATTG GAGGCAAGTTTGGGTAATGCATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077633: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776332130816AA433339TEUF0191T.cruzi epimastigote non-normalized cDNA Library


Date: 21:1:4 on Wed 22 Nov 117.