EST 1077636 is a singleton


Sequence

>1077636 (1 EST) Length=122 GGGAGCAATTAACAAGAACATTGGGACATGGGCGTCGGTGTTGTCAATAAAGGTGGGCGATGATGATGCTGAGGATGAGG ATGCGCGCCGCCTGTTTTGTGCTTAAACTCACCCGGCCTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776362130819AA433342TEUF0199T.cruzi epimastigote non-normalized cDNA Library


Date: 12:39:58 on Thu 18 Jan 118.