EST 1077642 is a singleton


Sequence

>1077642 (1 EST) Length=202 AGTTGAGAAGGTCATCCCACAGAAGCCGTCTTACATCCGTCTGCATCGCGGTGAACGGGGGGTGTTCAAAAATGTTGTCT TTGTGAAGTACCCCAATCGCGAGGTCGCGGAGGAAAGTAAGTTGCGCCTTGAACCGGTTTTTCATTGGATCGCGGCCAAA TTTAAAGGTGGGGTTTAAAAGAAGGAAAAGGGACCCGCGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077642: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776422130825AA433348TEUF0205T.cruzi epimastigote non-normalized cDNA Library


Date: 0:5:17 on Sun 19 Nov 117.