EST 1077643 is a singleton


Sequence

>1077643 (1 EST) Length=219 ACACGAATGCGGAGGAAGAGGGCCCGGCATTCGGGTTTGCAACACGCATGGTTCAAGCGCATTGTGACGCTTTGCCGGAA TTTTGTGTTCGATTCCCAAGCCTAATAGTGGAATGTGATACTTTGTATGAAGTGTGTCATGGAGATCTTGTCACGCTTTG TGACATTTTGGGAAATCTGCTGTGGTCTGGTTGTTACCGGGTTGTTCATGGGAAAACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077643: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776432130826AA433349TEUF0207T.cruzi epimastigote non-normalized cDNA Library


Date: 13:3:38 on Sun 19 Nov 117.