EST 1077644 is a singleton


Sequence

>1077644 (1 EST) Length=154 GTTTCTGTACTATATTGTTGGCACACAACATATTGCACAGTCTGCCGCGGTCCCTTTACTCGAGGGCCCCGCAGAGAGCA ACAACAGCAAGAACACGAACAAACAGGCCGAGAGAAGAGTTTGTTGAATAGCCGGGATTTTTTATTGGTTTTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077644: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776442130827AA433350TEUF0208T.cruzi epimastigote non-normalized cDNA Library


Date: 22:51:50 on Wed 22 Nov 117.