EST 1077645 is a singleton


Sequence

>1077645 (1 EST) Length=203 AGTTTCTGTACTATATTGAGGTTTACTGAGGGGGGATGCCGGATGCAGAGATGCCGGAGACGCGTGAAGGTCTCGTTCTT TTCCCACGTTGCTTGGCGCGTGCCTTCCGCTGCCTGAGGGATGTGCCCATTGTGCACTTTGTAGCGGTAACCAAAGTCAA TCGCCGGGGAAACGTCCAGCGAAAGCTTTTCTTGTCAACACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077645: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776452130828AA433351TEUF209T.cruzi epimastigote non-normalized cDNA Library


Date: 10:57:20 on Tue 21 Nov 117.