EST 1077649 is a singleton


Sequence

>1077649 (1 EST) Length=141 AGGACGCAAAACCATTGGAGCAGGCCGTCGCTGCAGAGGCGGCACCGGTGGTACCGGCAACGTAGGGCTGCAGTTATGTT GCAGTCCCGCTTGAAAAGGTCGCGGAGTTGTCCAATGAGGCCCTCACAGTCATTGCCGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077649: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776492130832AA433355TEUF0214T.cruzi epimastigote non-normalized cDNA Library


Date: 2:49:39 on Sat 25 Nov 117.