EST 1077651 is a singleton


Sequence

>1077651 (1 EST) Length=183 GTTTCTGTACTATATTGAACGTTTTTAGGCGCGGTCAGCCGGAACCGACAGCGCTGACGGAAGCCGGTAGACCGAACGGA ATTGCGAGACGGGGGGAAGGAAACAAATATAAGCAAATCAATCAATAAATAACTAAATAAGGAGAGACATGTCGGCGAGG GACTTCTTCTCCATTACGACCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077651: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776512130834AA433357TEUF0216T.cruzi epimastigote non-normalized cDNA Library


Date: 4:0:14 on Sun 19 Nov 117.