EST 1077653 is a singleton


Sequence

>1077653 (1 EST) Length=215 GTCCAATAACTCTTGAAGTAGGTCCCAACCCCATTTCGATTAAGCATACGACATCAGTTGGGGAGGAATCTCAAATTTTA TCCGATGCCGCCATGAGGGCGTTGCGTCAGGAACGTGATGTCATCTACAAATCTCCCCCAAAATATACAAGTTCGATAGG AAAATCGGTGTCATGTTAGGCCTGACACGTGATCAGTACCGAAATAGTCCTTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077653: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776532130836AA433359TEUF0218T.cruzi epimastigote non-normalized cDNA Library


Date: 9:3:41 on Tue 21 Nov 117.