EST 1077654 is a singleton


Sequence

>1077654 (1 EST) Length=215 GAGGGAATTAAGGTCCCAAAGATAAAGAGGGAAGAAGAAGAAGAAGAAGCATAAAAACGGCAGGTACGTAAAAAGCTACC GAGAGGATTTGTAAGGAGTGGGTAGTAAACAGAAATCAGGTCATACAAGATAACTCAGCTGCTGGGCTTCGTTGACGCAC AAAAGAAGAGCGACCTGTAGAACTGAATCTAAGAGACAGGCAACATTTTGAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077654: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776542130837AA433360TEUF0219T.cruzi epimastigote non-normalized cDNA Library


Date: 9:35:48 on Fri 24 Nov 117.