EST 1077655 is a singleton


Sequence

>1077655 (1 EST) Length=399 GTACATAATCCGAACGGGGATTTAATTTCTTTGTGCAATTTGGACAGCAATATTGTAAGGGTTCTCTACGAACGATTTGG CATTCGTAATCACGGCGACGATCCACGGAAGGTTTTGTCTGTTTCGGCGTACCAAACGGAGAAGTGGTGGATAAATCGTA CCATCATGAGTAATGAGGAGTCACTGGCAATGTTTGGTGTGGTGCCCGACTTGCATCCAGATCTTCTTAAGGAATTTCCC ACCACTGGCGTTGGCAAAGTGTGTTTTCGTTGCTACGGCAGGGATATCTTGCACCAGTACGGAGCTTGGAATTAAAAGAA CTATTTCATGGACGTGCCACAGCTGTNAATGTCGTCAGAAATTTCCTTTGGGTGTCATGGGTGCGGGGGNTTTCAAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077655: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776552130838AA433361TEUF0022T.cruzi epimastigote non-normalized cDNA Library


Date: 4:59:43 on Sat 18 Nov 117.