EST 1077656 is a singleton


Sequence

>1077656 (1 EST) Length=166 GTTTCTGTACTATATTGTATACCCAAACAAAGCTATTCTTCTTATAGGCCATTCAAGAAACATATAAGAAAGACATCAAT ACAACAGTAACAACATCTGAAAGAAAAAACAGTGTGAAAAAATACGTGATTGCTTTGACACACAAACAATCAACGAAACA AAGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077656: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776562130839AA433362TEUF0221T.cruzi epimastigote non-normalized cDNA Library


Date: 19:31:40 on Sun 19 Nov 117.