EST 1077657 is a singleton


Sequence

>1077657 (1 EST) Length=279 GTTTCTGTACTATATTGGTGAGAAGAGCGTTGACTCCACTGGCAGTGGGTAAGAACATGGCGGAGGTGGGAGGGAATAAT GTGGACATTGACGAGCTGGTGGATCATTACTTGGGGATTCCCGTAGCAGCCAGGCAAGGATCCGTGTTTTCTGGTGACAA CAATGATGACACGCACCCGCAGCACATGGGCAGTTTCTCGACACCCGCAGCTCATCCGGTGAAGACAATAACAAGTATAG TGAAGTAGATGGAAATCGTCAAGATGTCCTCACAAGTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077657: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776572130840AA433363TEUF0225T.cruzi epimastigote non-normalized cDNA Library


Date: 17:19:46 on Fri 24 Nov 117.