EST 1077659 is a singleton


Sequence

>1077659 (1 EST) Length=199 GTGCGCCGTCGTCGGTGGTGTTGAATTTCAGCGACGCCCTGCGCACGATGACTTTTGGGCGGCGCGCCTAGCATTTTCAT GATGGGGCCGCGTTCATTTTTGCACAGGACTATGTACGANGGCGGACGCGTTGGCAAATTCTACCCAGCCGCTGACCGGG GAAAGGAGCAGCGAGCACGATCTTCTCGTGGACGGCTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077659: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776592130842AA433365TEUF0228T.cruzi epimastigote non-normalized cDNA Library


Date: 10:35:7 on Mon 20 Nov 117.