EST 1077660 is a singleton


Sequence

>1077660 (1 EST) Length=204 GTTTCTGTACTATATTGGAGTAATTACGTGAACACAACTCGCGTTACAAGGAGGGATACTAATAAAAGAGAGCAACGACA GGCAACTTATAGCAGAATTAAAGGGGAAGGCAAGAAAAAACACACAACAACGAAGCAAACACAACAGATAGCGACCTTCG AAAAGGCAGACGAAATACAGGGGAACTTTAAGGCATTCATTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077660: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776602130843AA433366TEUF0229T.cruzi epimastigote non-normalized cDNA Library


Date: 12:4:27 on Fri 24 Nov 117.