EST 1077661 is a singleton


Sequence

>1077661 (1 EST) Length=243 GGGCGGAGTCATACTTCNTGGGGCCGATGGTTTAAAGATTGGTGTGGGACCTGGAAGTATTTCCACCACCCGTTTTGTCG CGGAGCTCCGGTGTGCCGCAGCTCATTGCCGTAATGGAATGCACGCTTGTGGCACGTAAACACGGCGTTCCATGCATTGC GGACGGTGGGATAAAGATGGCGGGTAATATCTGCAAAGCCATCGCCGGGGGGGCCGACACCGTCATGGTTGGAAATATTC TTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1077661: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776612130844AA433367TEUF0023T.cruzi epimastigote non-normalized cDNA Library


Date: 18:40:34 on Sat 18 Nov 117.