EST 1077662 is a singleton


Sequence

>1077662 (1 EST) Length=193 CACCATCAAAAACCATACGGTTCTCTTGTTCATTTTTTGGACTACATGGGAGTGTTGGGGCAAATGTACCGGNAGTACCA CGAAACATCCAACACGTTCCACTTTCTTCCACAGTTTCATTCCACGTGCCAAGGTCAGCACGACGTCTGGTATGGCCTTT TAATGCTTCGCCGTCATGGATTGCCTCATCTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1077662: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776622130845AA433368TEUF0230T.cruzi epimastigote non-normalized cDNA Library


Date: 17:55:51 on Mon 20 Nov 117.