EST 1077663 is a singleton


Sequence

>1077663 (1 EST) Length=216 GCATGATGCTGGCGACGGTGGCCCACCCGCACGTCCAGGCCCGTACAATTGGCATTAATCACGAAGAGGCGTTTCTGGAG AGGTACCGTCGCTTCACTGACGACGAGCAGCGCGCTGTGGAGGCGTCAGAGGCGAAGATACGGCAGTTCCGCCAAGATAT GGACAAATTGGGCCTCAAGTACAACAACACCGGATTATGTCAGGATGAAGTTCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1077663: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776632130846AA433369TEUF0231T.cruzi epimastigote non-normalized cDNA Library


Date: 4:21:1 on Thu 23 Nov 117.