EST 1077668 is a singleton


Sequence

>1077668 (1 EST) Length=247 CTATATTGAGGTGGAACACGAAATAAAGCAGACAAGCAAAAAAAACAACAACAAAAAACAATAAAAGAAGTGTGAATCAT GTTCACTCGTTTGAGCCGCACTTGCATCCCGAAGGGCGTGAGCGTTCAGCGCCGTTTCTTCAACATCCACGAGTACCAGT CGAAGGCCATTCTGAAGGAAGGCGGGCTGCAAGACAGAGTTTGGCATCCCGTGCCGAACCCTTGAGTAGGTGGAGGCCGC TCTGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1077668: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
10776682130851AA433374TEUF0246T.cruzi epimastigote non-normalized cDNA Library


Date: 4:25:59 on Mon 20 Nov 117.